View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-49 (Length: 37)
Name: NF4329-Insertion-49
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-49 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.000000000008
Query Start/End: Original strand, 3 - 37
Target Start/End: Complemental strand, 54083025 - 54082991
Alignment:
| Q |
3 |
atattttagggtgatttctgtttggtatatttatg |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
54083025 |
atattttagggtgatttctgtttggtatatttatg |
54082991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University