View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-50 (Length: 311)
Name: NF4329-Insertion-50
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-50 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 86 - 311
Target Start/End: Original strand, 24750109 - 24750334
Alignment:
| Q |
86 |
caattaactagttacaatgccaccaatatctggaaaactattcaccgttagtttgataagtttttggtatgcatcaaacattggtgtattactattaaac |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24750109 |
caattaactagttacaatgccaccaatatctggaaaactattcaccgttagtttgataagtttttggtatgcatcaaacattggtgtattactattaaac |
24750208 |
T |
|
| Q |
186 |
aagtaccttttaagcaactatggtttcaagtacccaatattcttaacactatgtcacatgatggcatgttcaatgttaagttacattgcaatatcatgga |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24750209 |
aagtaccttttaagcaactatggtttcaagtacccaatattcttaacactatgtcacatgatggcatgttcaatgttaagttacattgcaatatcatgga |
24750308 |
T |
|
| Q |
286 |
tgaaggtggtgccattgcaaacagtg |
311 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
24750309 |
tgaaggtggtgccattgcaaacagtg |
24750334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 150 - 217
Target Start/End: Original strand, 31330236 - 31330303
Alignment:
| Q |
150 |
tggtatgcatcaaacattggtgtattactattaaacaagtaccttttaagcaactatggtttcaagta |
217 |
Q |
| |
|
|||||| |||| ||||||||||| | ||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
31330236 |
tggtattcatccaacattggtgttcttctattgaacaagtatttgttaagcaactatggtttcaagta |
31330303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University