View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-54 (Length: 47)
Name: NF4329-Insertion-54
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-54 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 45; Significance: 1e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-17
Query Start/End: Original strand, 3 - 47
Target Start/End: Original strand, 45412723 - 45412767
Alignment:
| Q |
3 |
caatcattaccctcgaccatgaccaacccacttccaaacatggga |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45412723 |
caatcattaccctcgaccatgaccaacccacttccaaacatggga |
45412767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.0000000000007
Query Start/End: Original strand, 3 - 43
Target Start/End: Original strand, 45422126 - 45422166
Alignment:
| Q |
3 |
caatcattaccctcgaccatgaccaacccacttccaaacat |
43 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45422126 |
caatcattgccctcgaccatgaccaacccacttccaaacat |
45422166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University