View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-61 (Length: 64)
Name: NF4329-Insertion-61
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-61 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 2e-26; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 2e-26
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 50834647 - 50834584
Alignment:
| Q |
1 |
gaattgatgccaagaatccatgtgaaaggtacaggagaatatgcccatggaaggacgggattga |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50834647 |
gaattgatgccaagaatccatgtgaaaggtacaggagaatatgcccatggaaagacgggattga |
50834584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 2e-26
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 50841206 - 50841269
Alignment:
| Q |
1 |
gaattgatgccaagaatccatgtgaaaggtacaggagaatatgcccatggaaggacgggattga |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50841206 |
gaattgatgccaagaatccatgtgaaaggtacaggagaatatgcccatggaaagacgggattga |
50841269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University