View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329-Insertion-9 (Length: 156)
Name: NF4329-Insertion-9
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329-Insertion-9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 5e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 5e-51
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 39299699 - 39299808
Alignment:
| Q |
1 |
ccagaaaccactttggttcggctatcaagtttttctctatcatctgttaaaccttttgattccatttgaaactttcccacatcacgaaaaccaccaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39299699 |
ccagaaaccactttggttcggctatcaagtttttctctatcatcggttaaaccttttgattccatttgaaactttcccacatcacgaacaccaccaaaat |
39299798 |
T |
 |
| Q |
101 |
cttcttttcc |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
39299799 |
cttcttttcc |
39299808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 121 - 156
Target Start/End: Original strand, 39299804 - 39299839
Alignment:
| Q |
121 |
tttcctgctacatttgcactatcacgaacatgtgca |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299804 |
tttcctgctacatttgcactatcacgaacatgtgca |
39299839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University