View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329_low_14 (Length: 257)
Name: NF4329_low_14
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 9499838 - 9500044
Alignment:
| Q |
19 |
actccaccatttgttgcctactttcaatttctgtacatggtttgttattgtctgctagaatattatggcgtcgtttgatccacttagtgggataaggcta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9499838 |
actccaccatttgttgcctactttcaatttctgtacatggtctgttattgtctgctagaatattatggcgtcgtttgatccactcagtgggataaggcta |
9499937 |
T |
 |
| Q |
119 |
ggttgttgtttattactgtttgctgaccgttctggtatgttgctggccatccctcccactgttcttttttcacatgtcagtgagctttgttctgtttttg |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9499938 |
ggttgttgtttattactgtctgctgaccgttctggtatgttgctggccatccctcccactgttcttttttcacatgtcagtgagctttgttctg-ttttg |
9500036 |
T |
 |
| Q |
219 |
cataactt |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
9500037 |
cataactt |
9500044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University