View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4329_low_14 (Length: 257)

Name: NF4329_low_14
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4329_low_14
NF4329_low_14
[»] chr4 (1 HSPs)
chr4 (19-226)||(9499838-9500044)


Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 9499838 - 9500044
Alignment:
19 actccaccatttgttgcctactttcaatttctgtacatggtttgttattgtctgctagaatattatggcgtcgtttgatccacttagtgggataaggcta 118  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
9499838 actccaccatttgttgcctactttcaatttctgtacatggtctgttattgtctgctagaatattatggcgtcgtttgatccactcagtgggataaggcta 9499937  T
119 ggttgttgtttattactgtttgctgaccgttctggtatgttgctggccatccctcccactgttcttttttcacatgtcagtgagctttgttctgtttttg 218  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
9499938 ggttgttgtttattactgtctgctgaccgttctggtatgttgctggccatccctcccactgttcttttttcacatgtcagtgagctttgttctg-ttttg 9500036  T
219 cataactt 226  Q
    ||||||||    
9500037 cataactt 9500044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University