View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4329_low_19 (Length: 237)
Name: NF4329_low_19
Description: NF4329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4329_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 32641489 - 32641720
Alignment:
| Q |
1 |
ttaagtataaatcaacttatctgactgaaatnnnnnnngaataaatcaaatttcctgtaaacaatattagtatttggaaaatgctagatagccagccact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32641489 |
ttaagtataaatcaacttatctgactgaaataaaaaaagaataaatcaaatttcctgtaaacaatattagtatttggaaaatgctagatagccggccact |
32641588 |
T |
|
| Q |
101 |
ccttgtaatttaaggac-tcccaggcttc---------nnnnnnnnnnggttaagcccaggcttcnnnnnnnnacaatcaataaaataagaatctaacaa |
190 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
32641589 |
ccttgtaatttaaggacttcccaggcttcttatttttttattttttttggttaagcccaggcttcttatttttactatcaacaaaataagaatctaacaa |
32641688 |
T |
|
| Q |
191 |
gacttgtcatcattgaattttgggtcgaacat |
222 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| |
|
|
| T |
32641689 |
gacttgttatcattgaattctgggtcgaacat |
32641720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University