View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4330-Insertion-12 (Length: 60)
Name: NF4330-Insertion-12
Description: NF4330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4330-Insertion-12 |
 | |
|
| [»] chr6 (3 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 54; Significance: 8e-23; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 3 - 60
Target Start/End: Original strand, 26563966 - 26564023
Alignment:
| Q |
3 |
ataccattcaaaatttggtgtttatctcgagcatgaaatcgaatcaaacacttctggg |
60 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26563966 |
ataccattcaaaattcggtgtttatctcgagcatgaaatcgaatcaaacacttctggg |
26564023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 53
Target Start/End: Original strand, 26551832 - 26551882
Alignment:
| Q |
3 |
ataccattcaaaatttggtgtttatctcgagcatgaaatcgaatcaaacac |
53 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||| |||| |||||| |
|
|
| T |
26551832 |
ataccattcaaagtttggcgtttatctcgagcatgaaattgaattaaacac |
26551882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.00000000006
Query Start/End: Original strand, 3 - 56
Target Start/End: Original strand, 26558478 - 26558531
Alignment:
| Q |
3 |
ataccattcaaaatttggtgtttatctcgagcatgaaatcgaatcaaacacttc |
56 |
Q |
| |
|
||||||||||||||||| ||||||||| ||| | ||||| |||||||||||||| |
|
|
| T |
26558478 |
ataccattcaaaatttgatgtttatcttgagaaggaaattgaatcaaacacttc |
26558531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 3 - 56
Target Start/End: Complemental strand, 50935850 - 50935797
Alignment:
| Q |
3 |
ataccattcaaaatttggtgtttatctcgagcatgaaatcgaatcaaacacttc |
56 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
50935850 |
ataccattcaaagtttggtgtttatctcgagcatgaagtgaaatcaaacacttc |
50935797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University