View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4330-Insertion-14 (Length: 128)
Name: NF4330-Insertion-14
Description: NF4330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4330-Insertion-14 |
 | |
|
| [»] scaffold0912 (1 HSPs) |
| |
|
| [»] scaffold0043 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0912 (Bit Score: 73; Significance: 9e-34; HSPs: 1)
Name: scaffold0912
Description:
Target: scaffold0912; HSP #1
Raw Score: 73; E-Value: 9e-34
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 1216 - 1092
Alignment:
| Q |
1 |
ggaagaacaggctggcaagcatatccaagagaacattgccgagacaaaaaagagttgnnnnnnnggattttgccctgattgtatttggagatataaaagg |
100 |
Q |
| |
|
|||| |||| |||||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1216 |
ggaaaaacatgctggcaagcatattcaagagaaca---ccgagacaaaaaagagttgtttttttggattttgccctgattgtatttggagatataaaagg |
1120 |
T |
|
| Q |
101 |
ggagaggagttgacaacaaagacaaagg |
128 |
Q |
| |
|
||||| |||||| ||||||||||||||| |
|
|
| T |
1119 |
ggagaagagttggcaacaaagacaaagg |
1092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 8e-25; HSPs: 9)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 8e-25
Query Start/End: Original strand, 65 - 122
Target Start/End: Original strand, 27368309 - 27368366
Alignment:
| Q |
65 |
ggattttgccctgattgtatttggagatataaaaggggagaggagttgacaacaaaga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27368309 |
ggattttgccctgattgtatttggagatataaaaggggagaggagttgacaacaaaga |
27368366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 65 - 126
Target Start/End: Complemental strand, 26185741 - 26185680
Alignment:
| Q |
65 |
ggattttgccctgattgtatttggagatataaaaggggagaggagttgacaacaaagacaaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
26185741 |
ggattttgccctgattgtatttggagatataaaaggggagaggagttggcaaccaagacaaa |
26185680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 65 - 126
Target Start/End: Complemental strand, 26119282 - 26119221
Alignment:
| Q |
65 |
ggattttgccctgattgtatttggagatataaaaggggagaggagttgacaacaaagacaaa |
126 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
26119282 |
ggatttttccctgattgtatttggagatataaaaggggagaggagttggcaaccaagacaaa |
26119221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 65 - 126
Target Start/End: Complemental strand, 26214348 - 26214287
Alignment:
| Q |
65 |
ggattttgccctgattgtatttggagatataaaaggggagaggagttgacaacaaagacaaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||||||| |
|
|
| T |
26214348 |
ggattttgccctgattgtatttggagatataaaaggggagaggatttggcaaccaagacaaa |
26214287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 65 - 126
Target Start/End: Complemental strand, 26241546 - 26241485
Alignment:
| Q |
65 |
ggattttgccctgattgtatttggagatataaaaggggagaggagttgacaacaaagacaaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |||| |||||||| |
|
|
| T |
26241546 |
ggattttgccctgattgtatttggagatatgaaaggggagaggagttggcaaccaagacaaa |
26241485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 65 - 128
Target Start/End: Original strand, 27342025 - 27342088
Alignment:
| Q |
65 |
ggattttgccctgattgtatttggagatataaaaggggagaggagttgacaacaaagacaaagg |
128 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| || ||| | ||||||||||||| |
|
|
| T |
27342025 |
ggattttgtcctgattgtatttggagatataaaaggggagaagacttgtcgacaaagacaaagg |
27342088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 68 - 128
Target Start/End: Complemental strand, 26147268 - 26147208
Alignment:
| Q |
68 |
ttttgccctgattgtatttggagatataaaaggggagaggagttgacaacaaagacaaagg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||| |||| |||| ||||| |
|
|
| T |
26147268 |
ttttgccctgattgtatttggagatataaaaggggaaaagagttggcaaccaagataaagg |
26147208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 65 - 128
Target Start/End: Complemental strand, 18725427 - 18725364
Alignment:
| Q |
65 |
ggattttgccctgattgtatttggagatataaaaggggagaggagttgacaacaaagacaaagg |
128 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| ||||| || ||| | ||||||||||||| |
|
|
| T |
18725427 |
ggattttgtcctgattgtatatggagatataaaagaggagaagacttgtcgacaaagacaaagg |
18725364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 65 - 115
Target Start/End: Complemental strand, 18083292 - 18083242
Alignment:
| Q |
65 |
ggattttgccctgattgtatttggagatataaaaggggagaggagttgaca |
115 |
Q |
| |
|
|||||||| ||||||||||| ||||||| |||||||||||||||| ||||| |
|
|
| T |
18083292 |
ggattttgtcctgattgtatatggagatgtaaaaggggagaggagctgaca |
18083242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 65 - 128
Target Start/End: Complemental strand, 75236 - 75173
Alignment:
| Q |
65 |
ggattttgccctgattgtatttggagatataaaaggggagaggagttgacaacaaagacaaagg |
128 |
Q |
| |
|
|||||||| ||||||| ||| |||||||||||||||||||| || ||| ||||||||||||| |
|
|
| T |
75236 |
ggattttgtcctgattttatatggagatataaaaggggagaagacttgttgacaaagacaaagg |
75173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University