View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4330-Insertion-15 (Length: 180)
Name: NF4330-Insertion-15
Description: NF4330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4330-Insertion-15 |
 | |
|
| [»] chr7 (6 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 5e-73; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 5e-73
Query Start/End: Original strand, 6 - 180
Target Start/End: Complemental strand, 35766603 - 35766429
Alignment:
| Q |
6 |
tttgtgctacggttggctcagtttcgtggcagaaggtaatagaaggcaagaggttttggtttctgcatccaaatgtggtcaactgggacgactctgctgt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
35766603 |
tttgtgctacggttggctcagtttcgtggaagaaggtaatagaaggcaagaggtttatgtttctgcatccaacagtgatcaactgggacgactctgctgt |
35766504 |
T |
|
| Q |
106 |
caaagaggcattcgacaatgccaagaacaggttttgggctgatatcaacggccttccctgcgaaataccattgcc |
180 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
35766503 |
caaagaggcattcgacaatgctaagaacaggttttgggctgatatcaacggctttccctgcgacataccattgcc |
35766429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 15 - 180
Target Start/End: Complemental strand, 35761111 - 35760946
Alignment:
| Q |
15 |
cggttggctcagtttcgtggcagaaggtaatagaaggcaagaggttttggtttctgcatccaaatgtggtcaactgggacgactctgctgtcaaagaggc |
114 |
Q |
| |
|
|||||||||||||| | |||| ||||||||||||||||||| || | || ||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35761111 |
cggttggctcagttccatggcgaaaggtaatagaaggcaagaagtatatgtatctgcatcccaatgtggtaaactgggacgactctgctgtcaaagaggc |
35761012 |
T |
|
| Q |
115 |
attcgacaatgccaagaacaggttttgggctgatatcaacggccttccctgcgaaataccattgcc |
180 |
Q |
| |
|
||| |||||||| || ||||| ||||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
35761011 |
atttgacaatgcaaaaaacagattttgggctgagatcaacgaatttccctgcgacataccattgcc |
35760946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 79; E-Value: 3e-37
Query Start/End: Original strand, 6 - 180
Target Start/End: Complemental strand, 35799553 - 35799379
Alignment:
| Q |
6 |
tttgtgctacggttggctcagtttcgtggcagaaggtaatagaaggcaagaggttttggtttctgcatccaaatgtggtcaactgggacgactctgctgt |
105 |
Q |
| |
|
|||||||| |||| ||||||||| | |||| ||| ||||||||| |||||||| || | ||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
35799553 |
tttgtgcttcggtgggctcagttccatggcgaaagctaatagaagacaagaggtacatgtatatgcatcccaaagtggtaaactgggacgactctgctgt |
35799454 |
T |
|
| Q |
106 |
caaagaggcattcgacaatgccaagaacaggttttgggctgatatcaacggccttccctgcgaaataccattgcc |
180 |
Q |
| |
|
||||||||||||||||||||| || ||||||| ||||||||| ||||||||| ||||||| || ||||||||||| |
|
|
| T |
35799453 |
caaagaggcattcgacaatgcaaaaaacaggtattgggctgagatcaacggcattccctgggacataccattgcc |
35799379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 75; E-Value: 8e-35
Query Start/End: Original strand, 42 - 180
Target Start/End: Complemental strand, 35755926 - 35755788
Alignment:
| Q |
42 |
taatagaaggcaagaggttttggtttctgcatccaaatgtggtcaactgggacgactctgctgtcaaagaggcattcgacaatgccaagaacaggttttg |
141 |
Q |
| |
|
||||||||| |||||||| | || ||| ||||| |||||||| |||||||| ||||||||||| |||||||||||| ||||||| || ||||||||||| |
|
|
| T |
35755926 |
taatagaagtcaagaggtatatgtctctacatcccaatgtggtaaactgggatgactctgctgtaaaagaggcattcaacaatgcaaaaaacaggttttg |
35755827 |
T |
|
| Q |
142 |
ggctgatatcaacggccttccctgcgaaataccattgcc |
180 |
Q |
| |
|
|||||| ||||||||||||||||| || ||||||||||| |
|
|
| T |
35755826 |
ggctgagatcaacggccttccctgtgacataccattgcc |
35755788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 38 - 180
Target Start/End: Complemental strand, 35786026 - 35785884
Alignment:
| Q |
38 |
aaggtaatagaaggcaagaggttttggtttctgcatccaaatgtggtcaactgggacgactctgctgtcaaagaggcattcgacaatgccaagaacaggt |
137 |
Q |
| |
|
||||||||||||||||| | || | || ||| || || || ||||| |||||| ||||||||||||||||||||||||| |||||||| || ||||||| |
|
|
| T |
35786026 |
aaggtaatagaaggcaataagtatatgtgtcttcaccccaaagtggtaaactggaacgactctgctgtcaaagaggcatttgacaatgcaaaaaacaggt |
35785927 |
T |
|
| Q |
138 |
tttgggctgatatcaacggccttccctgcgaaataccattgcc |
180 |
Q |
| |
|
|||||||||| |||||||||||||||||| | ||||||||||| |
|
|
| T |
35785926 |
tttgggctgagatcaacggccttccctgcaacataccattgcc |
35785884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 6 - 176
Target Start/End: Complemental strand, 35789910 - 35789740
Alignment:
| Q |
6 |
tttgtgctacggttggctcagtttcgtggcagaaggtaatagaaggcaagaggttttggtttctgcatccaaatgtggtcaactgggacgactctgctgt |
105 |
Q |
| |
|
|||||||| || |||||||||| | |||| ||| ||||||||| ||||| | | || ||| ||||| |||||||| ||||||||||| ||||| || |
|
|
| T |
35789910 |
tttgtgcttcgattggctcagtaccatggcgaaagataatagaagtcaagaaatatatgtgtctacatcccaatgtggtaaactgggacgattctgccgt |
35789811 |
T |
|
| Q |
106 |
caaagaggcattcgacaatgccaagaacaggttttgggctgatatcaacggccttccctgcgaaataccat |
176 |
Q |
| |
|
||||||||||||| ||||||| || |||||||| |||||||| ||||||| | |||||||||| ||||||| |
|
|
| T |
35789810 |
caaagaggcattcaacaatgcaaaaaacaggttctgggctgagatcaacgacattccctgcgacataccat |
35789740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University