View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4330-Insertion-18 (Length: 82)

Name: NF4330-Insertion-18
Description: NF4330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4330-Insertion-18
NF4330-Insertion-18
[»] chr5 (1 HSPs)
chr5 (9-81)||(15737237-15737309)
[»] chr2 (1 HSPs)
chr2 (9-82)||(25286587-25286661)


Alignment Details
Target: chr5 (Bit Score: 65; Significance: 3e-29; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 9 - 81
Target Start/End: Complemental strand, 15737309 - 15737237
Alignment:
9 tgataagtttaacttttctttctacaaaatactttatgaaaatcaacatggccttttgtttatatgccttaat 81  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||    
15737309 tgataagtttaacttttctttcgacaaaatactttatgaaaatcaacatggctttttgtttatatgccttaat 15737237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 51; Significance: 7e-21; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 7e-21
Query Start/End: Original strand, 9 - 82
Target Start/End: Complemental strand, 25286661 - 25286587
Alignment:
9 tgataagtttaacttttctttctacaaaatacttt-atgaaaatcaacatggccttttgtttatatgccttaatt 82  Q
    ||||||||||||| ||||||||||||||||| ||| ||||||||||||||| | |||||||||||||||||||||    
25286661 tgataagtttaacctttctttctacaaaatagttttatgaaaatcaacatgactttttgtttatatgccttaatt 25286587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University