View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4330-Insertion-18 (Length: 82)
Name: NF4330-Insertion-18
Description: NF4330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4330-Insertion-18 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 3e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 9 - 81
Target Start/End: Complemental strand, 15737309 - 15737237
Alignment:
| Q |
9 |
tgataagtttaacttttctttctacaaaatactttatgaaaatcaacatggccttttgtttatatgccttaat |
81 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15737309 |
tgataagtttaacttttctttcgacaaaatactttatgaaaatcaacatggctttttgtttatatgccttaat |
15737237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 7e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 7e-21
Query Start/End: Original strand, 9 - 82
Target Start/End: Complemental strand, 25286661 - 25286587
Alignment:
| Q |
9 |
tgataagtttaacttttctttctacaaaatacttt-atgaaaatcaacatggccttttgtttatatgccttaatt |
82 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||| ||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
25286661 |
tgataagtttaacctttctttctacaaaatagttttatgaaaatcaacatgactttttgtttatatgccttaatt |
25286587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University