View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4330-Insertion-19 (Length: 129)
Name: NF4330-Insertion-19
Description: NF4330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4330-Insertion-19 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 5e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 27079853 - 27079981
Alignment:
| Q |
1 |
cctttagcataccctttgaaactgtcggttccttcgttaaaagatttaccatagttatcaaaatcaacatgggtcccacccgttgagtccttagcatagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27079853 |
cctttagcataccctttgaaactgtcggttccttcgttaaaagatttaccatagttatcaaaatcaacatgggtcccacccgttgagtccttagcatagg |
27079952 |
T |
|
| Q |
101 |
aactaaacgagtcagcaccaacattggct |
129 |
Q |
| |
|
|| |||||||||| ||||| ||||||||| |
|
|
| T |
27079953 |
aagtaaacgagtcggcacccacattggct |
27079981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University