View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4330-Insertion-2 (Length: 155)
Name: NF4330-Insertion-2
Description: NF4330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4330-Insertion-2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 7e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 7e-72
Query Start/End: Original strand, 11 - 155
Target Start/End: Complemental strand, 3691803 - 3691659
Alignment:
| Q |
11 |
acttgccacatgtaaaactatttcttttctttagaattttcttctgctatagaatctcacctcttctgcaacaagagaatctagattctgtcattaattt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
3691803 |
acttgccacatgtaaaactatttcttttctttagaattttcttctgctatagaatctcacctcttctgcaacaagagaatctagattcagtcataaattt |
3691704 |
T |
 |
| Q |
111 |
agagaaagtcaacacttcatatcttagttatagctttgcaaatag |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3691703 |
agagaaagtcaacacttcatatcttagttatagctttgcaaatag |
3691659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University