View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4330-Insertion-21 (Length: 129)
Name: NF4330-Insertion-21
Description: NF4330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4330-Insertion-21 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 3e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 3e-64
Query Start/End: Original strand, 6 - 129
Target Start/End: Original strand, 70044 - 70167
Alignment:
| Q |
6 |
tactgtactgtactgtgtttttgcaggggcctgagattcggactggctttctcaaagatggaaaacctattcaactcaaagaaggacaagaaatcaccat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
70044 |
tactgtactgtactgtgtttttgcaggggcctgagattcggactggctttctcaaagatggaaaacctattcaactcaaagaaggacaagaaatcaccat |
70143 |
T |
|
| Q |
106 |
aactactgattatgaaatcaaggg |
129 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
70144 |
aactactgattatgaaatcaaggg |
70167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.0000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 30 - 90
Target Start/End: Complemental strand, 40597530 - 40597470
Alignment:
| Q |
30 |
aggggcctgagattcggactggctttctcaaagatggaaaacctattcaactcaaagaagg |
90 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||| |||||||| ||||| ||| |||| |
|
|
| T |
40597530 |
aggggcctgagattcgtactggatttctcaaggatggcaaacctatccaactgaaacaagg |
40597470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University