View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4330-Insertion-25 (Length: 115)

Name: NF4330-Insertion-25
Description: NF4330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4330-Insertion-25
NF4330-Insertion-25
[»] chr1 (1 HSPs)
chr1 (5-115)||(12452128-12452239)
[»] chr8 (1 HSPs)
chr8 (5-115)||(22715558-22715669)
[»] chr3 (1 HSPs)
chr3 (5-115)||(12480556-12480667)


Alignment Details
Target: chr1 (Bit Score: 92; Significance: 4e-45; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 92; E-Value: 4e-45
Query Start/End: Original strand, 5 - 115
Target Start/End: Original strand, 12452128 - 12452239
Alignment:
5 gcaaccatgtcgagagccaatgtgaaaatag-tctggccgtcgacgagacaagaaccggagcaggcgtccccaattctgcttgccaatcgaacatggcta 103  Q
    ||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
12452128 gcaaccatgtcgagagccaatgtgaaaataggtctgaccgtcgacgagacaagaaccggagcaggcgtccccaattctgcttgccaatcgaacatggcga 12452227  T
104 tcggcaaaactg 115  Q
    |||||| |||||    
12452228 tcggcagaactg 12452239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 76; Significance: 1e-35; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 5 - 115
Target Start/End: Complemental strand, 22715669 - 22715558
Alignment:
5 gcaaccatgtcgagagccaatgtgaaaatag-tctggccgtcgacgagacaagaaccggagcaggcgtccccaattctgcttgccaatcgaacatggcta 103  Q
    |||||||||||||||||||||||| || ||| ||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||    
22715669 gcaaccatgtcgagagccaatgtggaagtaggtctggtcgtcgacgagacaggaaccggagcaggcgtccccaattctgcttgccaatcgaacatgacta 22715570  T
104 tcggcaaaactg 115  Q
    || ||| |||||    
22715569 tcagcagaactg 22715558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 60; Significance: 4e-26; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 60; E-Value: 4e-26
Query Start/End: Original strand, 5 - 115
Target Start/End: Complemental strand, 12480667 - 12480556
Alignment:
5 gcaaccatgtcgagagccaatgtgaaaatag-tctggccgtcgacgagacaagaaccggagcaggcgtccccaattctgcttgccaatcgaacatggcta 103  Q
    |||||||||||||||||||| |||  | ||| | |||| |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |    
12480667 gcaaccatgtcgagagccaaagtggtagtaggtttggctgtcgacgagacatgaaccggaacaggcgtccccaattctgcttgccaatcgaacatggcaa 12480568  T
104 tcggcaaaactg 115  Q
    | |||| |||||    
12480567 ttggcagaactg 12480556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University