View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4330-Insertion-41 (Length: 89)
Name: NF4330-Insertion-41
Description: NF4330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4330-Insertion-41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 38; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 5 - 50
Target Start/End: Original strand, 4765064 - 4765108
Alignment:
| Q |
5 |
tcttcttcttgttttgtagattgtcacggttgttatttgttgatca |
50 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4765064 |
tcttcttcttgttttg-agattgtcacggttgttatttgttgatca |
4765108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 46 - 80
Target Start/End: Complemental strand, 31868809 - 31868775
Alignment:
| Q |
46 |
gatcaagattgttcaaaagggtatgtagaaaaaca |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
31868809 |
gatcaagattgttcaaaagggtatgtagaaaaaca |
31868775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 80
Target Start/End: Original strand, 24929089 - 24929120
Alignment:
| Q |
49 |
caagattgttcaaaagggtatgtagaaaaaca |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24929089 |
caagattgttcaaaagggtatgtagaaaaaca |
24929120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 51
Target Start/End: Complemental strand, 12065932 - 12065903
Alignment:
| Q |
22 |
agattgtcacggttgttatttgttgatcaa |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12065932 |
agattgtcacggttgttatttgttgatcaa |
12065903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University