View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4330-Insertion-8 (Length: 105)
Name: NF4330-Insertion-8
Description: NF4330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4330-Insertion-8 |
 |  |
|
| [»] scaffold0386 (1 HSPs) |
 |  |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0386 (Bit Score: 80; Significance: 5e-38; HSPs: 1)
Name: scaffold0386
Description:
Target: scaffold0386; HSP #1
Raw Score: 80; E-Value: 5e-38
Query Start/End: Original strand, 6 - 101
Target Start/End: Complemental strand, 2523 - 2429
Alignment:
| Q |
6 |
gatatttcagattttcttcaacatagcttacaacattgaggaaagtctctctcaatacccccatgcaatagaatttgcattcctcacgatagctta |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
2523 |
gatatttcagattttcttcaacatagcttacaacattgaggaaagtctctctcaatacccccatgcaataaaatttgcatt-ctcacgacagctta |
2429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 4e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 4e-26
Query Start/End: Original strand, 7 - 105
Target Start/End: Complemental strand, 6076060 - 6075961
Alignment:
| Q |
7 |
atatttcagattttcttcaacatagcttacaacattgaggaaagtctctctcaataccccc-atgcaatagaatttgcattcctcacgatagcttaactg |
105 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||| || ||| | ||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6076060 |
atatttcagaatttcttcaacatagcttacaacattggagaaagtccctttcattgccccccatgcaatagaatttgcattcctcacgatagcctaactg |
6075961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University