View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4330_low_10 (Length: 261)
Name: NF4330_low_10
Description: NF4330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4330_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 170 - 245
Target Start/End: Complemental strand, 48134349 - 48134274
Alignment:
| Q |
170 |
ccctaagaaaactcattaataagtttcaacccttttgttttaaaattgacatttttatgaaaaagtaaataaaaag |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48134349 |
ccctaagaaaactcattaataagtttcaactcttttgttttaaaattgacatttttatgaaaaagtaaataaaaag |
48134274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 170 - 245
Target Start/End: Original strand, 31563043 - 31563118
Alignment:
| Q |
170 |
ccctaagaaaactcattaataagtttcaacccttttgttttaaaattgacatttttatgaaaaagtaaataaaaag |
245 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31563043 |
ccctaagaaaactcataaataagtttcaactcttttgttttaaaattgacatttttatgaaaaagtaaataaaaag |
31563118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University