View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4331-Insertion-10 (Length: 128)
Name: NF4331-Insertion-10
Description: NF4331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4331-Insertion-10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 6 - 120
Target Start/End: Complemental strand, 5527654 - 5527540
Alignment:
| Q |
6 |
tctattgcaagtatggtcatattcaacagcaaactcaattcagcactatgtttgccattgcaagtgtagtctttttcaataccaattgaattcaccacta |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5527654 |
tctattgcaagtatggtcatattcaacagcaaactcaattcagcactatgtttgccattgcaagtgtagtctttttcaataccaattgaatttaccacta |
5527555 |
T |
|
| Q |
106 |
ccacttttttagttg |
120 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5527554 |
ccacttttttagttg |
5527540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University