View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4331-Insertion-4 (Length: 128)
Name: NF4331-Insertion-4
Description: NF4331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4331-Insertion-4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 6e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 6e-41
Query Start/End: Original strand, 13 - 128
Target Start/End: Original strand, 55932755 - 55932869
Alignment:
| Q |
13 |
tatgtatgaatatatatgtgcatgcatggaagttcctatggcaaag-aaaaacaaaataaaagttagatgtatcaatgagaaaaacaaacttcaaaccat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||||||||||| | ||||||||||| |
|
|
| T |
55932755 |
tatgtatgaatatatatgtgcatgcatggaagttcctatggcaaagaaaaaacaaaatcaaagtt-gatgtatcaatgagaaaaac-agcttcaaaccat |
55932852 |
T |
 |
| Q |
112 |
ggcaccacttttctatg |
128 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
55932853 |
ggcaccacttttctatg |
55932869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University