View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4331-Insertion-5 (Length: 192)
Name: NF4331-Insertion-5
Description: NF4331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4331-Insertion-5 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 2 - 192
Target Start/End: Complemental strand, 43389012 - 43388826
Alignment:
| Q |
2 |
aaaaaatggtaatattttaagggacgtgaattgggcaggtagactaaacaacaatgaactggatttgatttatcaaatcagatactaannnnnnnnnnnn |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43389012 |
aaaaaatggtaatattttaagggacgtgaattgggcaggtagactaaacaacaatgaactggatttgatttatcaaatcagatactaa-----tcttttc |
43388918 |
T |
|
| Q |
102 |
nnnnnnnnnccctttgt-aaaacaaataattcgaaacgactctattcatgagctgcgtatccttcactttgctcagcttttatatatgatga |
192 |
Q |
| |
|
|||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43388917 |
ttttctttcccctttgtaaaaacaaataagtcgaaatgactctattcatgagctgcgtatccttcactttgctcagcttttatatatgatga |
43388826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University