View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4331-Insertion-9 (Length: 102)
Name: NF4331-Insertion-9
Description: NF4331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4331-Insertion-9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 2e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 43398153 - 43398241
Alignment:
| Q |
11 |
ttggtcattttcattcactcacggctagaaaactttcaaaatccacatccatccataataaatgaataggggaagtttgttgaactatg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43398153 |
ttggtcattttcattcactcacggctagaaaactttcaaaatccacatccatccataataaatgaataggggaagtttgttgaactatg |
43398241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University