View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4331_low_12 (Length: 220)

Name: NF4331_low_12
Description: NF4331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4331_low_12
NF4331_low_12
[»] chr7 (1 HSPs)
chr7 (24-205)||(28947834-28948015)


Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 24 - 205
Target Start/End: Complemental strand, 28948015 - 28947834
Alignment:
24 gtggacagtcttcaccacaggagccattgcacatgtgctaacaaacagatgaactaagctagtgtaaaagtagaatactcaagtattcatttcatggtga 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28948015 gtggacagtcttcaccacaggagccattgcacatgtgctaacaaacagatgaactaagctagtgtaaaagtagaatactcaagtattcatttcatggtga 28947916  T
124 gtgactgtgttggtgccctatgcaaaccctaataattgcactctccataaatgctaatgtccttctcttttaactgtctgtg 205  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28947915 gtgactgtgttggtaccctatgcaaaccctaataattgcactctccataaatgctaatgtccttctcttttaactgtctgtg 28947834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University