View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4331_low_12 (Length: 220)
Name: NF4331_low_12
Description: NF4331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4331_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 24 - 205
Target Start/End: Complemental strand, 28948015 - 28947834
Alignment:
| Q |
24 |
gtggacagtcttcaccacaggagccattgcacatgtgctaacaaacagatgaactaagctagtgtaaaagtagaatactcaagtattcatttcatggtga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28948015 |
gtggacagtcttcaccacaggagccattgcacatgtgctaacaaacagatgaactaagctagtgtaaaagtagaatactcaagtattcatttcatggtga |
28947916 |
T |
 |
| Q |
124 |
gtgactgtgttggtgccctatgcaaaccctaataattgcactctccataaatgctaatgtccttctcttttaactgtctgtg |
205 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28947915 |
gtgactgtgttggtaccctatgcaaaccctaataattgcactctccataaatgctaatgtccttctcttttaactgtctgtg |
28947834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University