View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4331_low_7 (Length: 321)
Name: NF4331_low_7
Description: NF4331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4331_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 31 - 267
Target Start/End: Original strand, 37492829 - 37493065
Alignment:
| Q |
31 |
ttaaagatgtaaaatgagaaaagcagggacaagaaataaaactatatcaaaaaagcatatgcatgagttgtttcagaatctggaaacttggttgcattag |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492829 |
ttaaagatgtaaaatgagaaaagcagggacaagaaataaaactatatcaaaaaagcatatgcatgagttgtttcagaatctggaaacttggttgcattag |
37492928 |
T |
 |
| Q |
131 |
attaaagcttttggttggcaccccaaaaatgctgaatttgattggctaacttcaaacaattcgacacttgcctttctgatccctaaatttgtggatttct |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492929 |
attaaagcttttggttggcaccccaaaaatgctgaatttgattggctaacttcaaacaattcgacacttgcctttctgatccctaaatttgtggatttct |
37493028 |
T |
 |
| Q |
231 |
tttgaacaagtatacatgaggtcaaccgtacaatatt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37493029 |
tttgaacaagtatacatgaggtcaaccgtacaatatt |
37493065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University