View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4332-Insertion-2 (Length: 193)
Name: NF4332-Insertion-2
Description: NF4332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4332-Insertion-2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 9 - 69
Target Start/End: Original strand, 36097211 - 36097271
Alignment:
| Q |
9 |
tctcgggtggcataggcttggtatattcttcatgtgttttgggtactaggacagaggtagg |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36097211 |
tctcgggtggcataggcttggtatattcttcatgtgttttgggtactaggacagaggtagg |
36097271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 133 - 193
Target Start/End: Original strand, 36097341 - 36097401
Alignment:
| Q |
133 |
ctaggtgatgttgtgggtgtttttatgtttcgctcttggtgggattctgggtcacttttgg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36097341 |
ctaggtgatgttgtgggtgtttttatgtttcgctcttggtgggattctgggtcacttttgg |
36097401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University