View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4332-Insertion-2 (Length: 193)

Name: NF4332-Insertion-2
Description: NF4332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4332-Insertion-2
NF4332-Insertion-2
[»] chr4 (2 HSPs)
chr4 (9-69)||(36097211-36097271)
chr4 (133-193)||(36097341-36097401)


Alignment Details
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 9 - 69
Target Start/End: Original strand, 36097211 - 36097271
Alignment:
9 tctcgggtggcataggcttggtatattcttcatgtgttttgggtactaggacagaggtagg 69  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36097211 tctcgggtggcataggcttggtatattcttcatgtgttttgggtactaggacagaggtagg 36097271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 133 - 193
Target Start/End: Original strand, 36097341 - 36097401
Alignment:
133 ctaggtgatgttgtgggtgtttttatgtttcgctcttggtgggattctgggtcacttttgg 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36097341 ctaggtgatgttgtgggtgtttttatgtttcgctcttggtgggattctgggtcacttttgg 36097401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University