View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4332-Insertion-3 (Length: 122)
Name: NF4332-Insertion-3
Description: NF4332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4332-Insertion-3 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 5e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 5e-63
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 28522422 - 28522543
Alignment:
| Q |
1 |
taaccataatcatgaaatgttaactttgtattttctttatccatatatgagattaatgttacttttatttgggggtgtaaataaagatggctgttgaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28522422 |
taaccataatcatgaaatgttaactttgtattttctttatccatatatgagattaatgttacttttatttgggggtgtaaataaagatggctgttgaata |
28522521 |
T |
 |
| Q |
101 |
ctatgattttggaccttacaag |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28522522 |
ctatgattttggaccttacaag |
28522543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 6e-38
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 28456437 - 28456557
Alignment:
| Q |
1 |
taaccataatcatgaaatgttaactttgtattttctttatccatatatgagattaatgttacttttatttgggggtgt-aaataaagatggctgttgaat |
99 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||||||||||| ||||| | ||||| ||||||||||||||| |
|
|
| T |
28456437 |
taaccataatcatcaaatgttaactttgtattttctgtatccaaatatgagattaatgttacttttatt--ggggtctaaaatatagatggctgttgaat |
28456534 |
T |
 |
| Q |
100 |
actatgattttggaccttacaag |
122 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
28456535 |
actatgactttggaccttacaag |
28456557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University