View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4333_high_2 (Length: 364)
Name: NF4333_high_2
Description: NF4333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4333_high_2 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 135 - 364
Target Start/End: Original strand, 34899746 - 34899975
Alignment:
| Q |
135 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttgggagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899746 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
34899845 |
T |
|
| Q |
235 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899846 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
34899945 |
T |
|
| Q |
335 |
gtttggtagtttcaactttcaagttgagat |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34899946 |
gtttggtagtttcaactttcaagttgagat |
34899975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 6 - 75
Target Start/End: Original strand, 43075175 - 43075244
Alignment:
| Q |
6 |
agaagcagagaggtacagaagagaatgaaagtgaaaatggtgtgaaagggaagaaggaatggaccactga |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43075175 |
agaagcagagaggtacagaagagaatgaaagtgaaaatggtgtgaaagggaagaaggaatggaccactga |
43075244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 90 - 118
Target Start/End: Complemental strand, 12279183 - 12279155
Alignment:
| Q |
90 |
accctaaccctaaccctaaccctaaccct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12279183 |
accctaaccctaaccctaaccctaaccct |
12279155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 91 - 119
Target Start/End: Original strand, 9491729 - 9491757
Alignment:
| Q |
91 |
ccctaaccctaaccctaaccctaacccta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9491729 |
ccctaaccctaaccctaaccctaacccta |
9491757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University