View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4333_high_8 (Length: 312)
Name: NF4333_high_8
Description: NF4333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4333_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 34891895 - 34891660
Alignment:
| Q |
17 |
atggacatcatcatttctttgtttgacttctaaaatacatttagcagagatcactcatgttttgtttgactcccttcagtactgtggcagctacattact |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34891895 |
atggacatcttcatttctttgtttgacttctaaaatacatttagcagagatcactcatgttttgcttgactcccttcagtactgtggcagctacattact |
34891796 |
T |
 |
| Q |
117 |
tctagtggaatcaattgccttttttcaaactgtcatttaaagaagttaacttaaaattagaaaagtcgctcttaaaatcaaggcaaattccattaccact |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34891795 |
tctagtggaatcaattgccttttttcaaactgtcatttaaagaagttaacttaaaattagaaaagtcgctcttaaaatcaaggcaaattccattaccact |
34891696 |
T |
 |
| Q |
217 |
gaactgcaacattgaaacttgccatgaagaattaaa |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34891695 |
gaactgcaacattgaaacttgccatgaagaactaaa |
34891660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 242 - 312
Target Start/End: Original strand, 34899905 - 34899975
Alignment:
| Q |
242 |
gaagaattaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat |
312 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899905 |
gaagaactaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat |
34899975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 27 - 78
Target Start/End: Complemental strand, 34891959 - 34891908
Alignment:
| Q |
27 |
tcatttctttgtttgacttctaaaatacatttagcagagatcactcatgttt |
78 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||| ||||||||||||| |
|
|
| T |
34891959 |
tcatttctttgtttgacttctaaagtacgtttagcagatatcactcatgttt |
34891908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University