View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4334_low_8 (Length: 204)
Name: NF4334_low_8
Description: NF4334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4334_low_8 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 8059411 - 8059609
Alignment:
| Q |
1 |
actattgttttttatattattggaatcgctactcctcgtttaattaccttgtaatcnnnnnnnnnnnnnnaggcttagaccctctctgtaacaaaaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8059411 |
actattgttttttatattattggaatcgctactcctcgtttaattaccttgtaatcatttttttt-----aggcttagaccctctctgtaacaaaaacaa |
8059505 |
T |
|
| Q |
101 |
caaacaaatgagggattacacataccaatcacctgtgtttagggacagatctacaactgtgactctgggaaaaatgcccccactgcaatttttacatcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8059506 |
caaacaaatgagggattacacataccaatcacctgtgtttagggacagatctacaactgtgactctgggaaaaatgcccccactgcaatttttacatcct |
8059605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University