View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4335-Insertion-1 (Length: 148)
Name: NF4335-Insertion-1
Description: NF4335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4335-Insertion-1 |
 | |
|
| [»] scaffold0735 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0735 (Bit Score: 65; Significance: 6e-29; HSPs: 2)
Name: scaffold0735
Description:
Target: scaffold0735; HSP #1
Raw Score: 65; E-Value: 6e-29
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 5864 - 5936
Alignment:
| Q |
1 |
tcttttccaatcgattgctgccctttagaggacaaacataaccagttaggctacattacattattccgccgat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
5864 |
tcttttccaatcgattgctgccctttagaggacaaacataactagttaggctatattacattattccgccgat |
5936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0735; HSP #2
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 108 - 148
Target Start/End: Original strand, 5967 - 6007
Alignment:
| Q |
108 |
aactgttttaaaacacttgattagttttgattgagctcaac |
148 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5967 |
aactgttttaaaacactcgattagttttgattgagctcaac |
6007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 6e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 6e-29
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 42924132 - 42924204
Alignment:
| Q |
1 |
tcttttccaatcgattgctgccctttagaggacaaacataaccagttaggctacattacattattccgccgat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
42924132 |
tcttttccaatcgattgctgccctttagaggacaaacataactagttaggctatattacattattccgccgat |
42924204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 108 - 148
Target Start/End: Original strand, 42924235 - 42924275
Alignment:
| Q |
108 |
aactgttttaaaacacttgattagttttgattgagctcaac |
148 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42924235 |
aactgttttaaaacactcgattagttttgattgagctcaac |
42924275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University