View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4335-Insertion-4 (Length: 284)
Name: NF4335-Insertion-4
Description: NF4335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4335-Insertion-4 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 54457002 - 54456718
Alignment:
| Q |
1 |
gtccttgccactggtctgtggaaaatgtttgatttcaggtggttgtgaagcatcaacagcaacagggttcatcatcatcatcggtgtagaatttgaccac |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54457002 |
gtccttgtcactggtctgtggaaaatgtttgatttcaggtggttgtgaagcatcaacagcaacagggttcatcatcatcatcggtgtagaatttgaccac |
54456903 |
T |
|
| Q |
101 |
acagaattgagaggcttctgcatagttccaaacgccccctccattgcaagctccctcctcacttcatcctccaactctatccgccgcaacatatcccgcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54456902 |
acagaattgagaggcttctgcatagttccaaacgccccctccattgcaagctccctcctcacttcatcctccaactctatccgccgcaacatatcccgcc |
54456803 |
T |
|
| Q |
201 |
tgatttgttccttctccatctctcgtcgtaatgccgcctcgttggtggccaatggtgctcggaagccagc-aaaccaccgtccac |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54456802 |
ggatttgttccttctccatctctcgtcgtaatgccgcctcgttggtggccaatggtgctcggaagccagcaaaaccaccgtccac |
54456718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 81 - 284
Target Start/End: Complemental strand, 54056601 - 54056397
Alignment:
| Q |
81 |
tcggtgtagaatttgaccacacagaattgagaggcttctgcatagttccaaacgccccctccattgcaagctccctcctcacttcatcctccaactctat |
180 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
54056601 |
tcggtgtagaatttgaccatagagaattgagaggcctctgcatggttccaaacgccccctccattgcaagctccctcctcacttcctcctccaactccat |
54056502 |
T |
|
| Q |
181 |
ccgccgcaacatatcccgcctgatttgttccttctccatctctcgtcgtaatgccgcctcgttggtggccaatggtgctcggaagccag-caaaccaccg |
279 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||| | ||| |||||| ||||||||| |
|
|
| T |
54056501 |
ccgcctcaacatatcccgccggatttgttccttctcgatctctcgtcgtaatgccgcctcattggtggccaacggtacccgggagccagaaaaaccaccg |
54056402 |
T |
|
| Q |
280 |
tccac |
284 |
Q |
| |
|
||||| |
|
|
| T |
54056401 |
tccac |
54056397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 117 - 189
Target Start/End: Original strand, 15039895 - 15039967
Alignment:
| Q |
117 |
tctgcatagttccaaacgccccctccattgcaagctccctcctcacttcatcctccaactctatccgccgcaa |
189 |
Q |
| |
|
||||||| |||||||||| || |||||||||||||||||||| ||| || |||||||| ||| || ||||||| |
|
|
| T |
15039895 |
tctgcatggttccaaacgtcctctccattgcaagctccctccacacctcctcctccaattctttctgccgcaa |
15039967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University