View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4335-Insertion-5 (Length: 91)
Name: NF4335-Insertion-5
Description: NF4335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4335-Insertion-5 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 43; Significance: 5e-16; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 5e-16
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 37956907 - 37956865
Alignment:
| Q |
49 |
aaacttttaagaaaatgcgtaatcttagaatgctccaattcta |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37956907 |
aaacttttaagaaaatgcgtaatcttagaatgctccaattcta |
37956865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 79
Target Start/End: Original strand, 37930756 - 37930811
Alignment:
| Q |
24 |
ataatgaaagttcaactacatgctgaaacttttaagaaaatgcgtaatcttagaat |
79 |
Q |
| |
|
|||| |||| || ||||||||| ||||||||| ||||| |||| |||||||||||| |
|
|
| T |
37930756 |
ataaagaaaattgaactacatgttgaaactttcaagaagatgcataatcttagaat |
37930811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University