View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4335_low_2 (Length: 240)
Name: NF4335_low_2
Description: NF4335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4335_low_2 |
 |  |
|
| [»] scaffold0735 (2 HSPs) |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0735 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: scaffold0735
Description:
Target: scaffold0735; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 76 - 240
Target Start/End: Complemental strand, 5810 - 5646
Alignment:
| Q |
76 |
cagtaatttaatcagctataaacccttgtgttattcttaaccacattcctctgtctctttctaacaatgtgagatatcgagactgagagagatagataga |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5810 |
cagtaatttaatcagctataaacccttgtgttattcttaaccacattcctctgtctctttctaacaatgtgagatttcgagactgagagagatagataga |
5711 |
T |
 |
| Q |
176 |
tgcacaacatatcatagcacatgcgtgtctgcactgcaccaccctcaccatccaaatccacatac |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5710 |
tgcacaacatatcatagcacatgcgtgtctgcactgcaccaccctcaccatccaaatccacatac |
5646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0735; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 64
Target Start/End: Complemental strand, 5862 - 5825
Alignment:
| Q |
28 |
ttactaccttatgttaaa-gccaataatttaatcttat |
64 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5862 |
ttactaccttatgttaaaagccaataatttaatcttat |
5825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 76 - 240
Target Start/End: Complemental strand, 42924078 - 42923914
Alignment:
| Q |
76 |
cagtaatttaatcagctataaacccttgtgttattcttaaccacattcctctgtctctttctaacaatgtgagatatcgagactgagagagatagataga |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42924078 |
cagtaatttaatcagctataaacccttgtgttattcttaaccacattcctctgtctctttctaacaatgtgagatttcgagactgagagagatagataga |
42923979 |
T |
 |
| Q |
176 |
tgcacaacatatcatagcacatgcgtgtctgcactgcaccaccctcaccatccaaatccacatac |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42923978 |
tgcacaacatatcatagcacatgcgtgtctgcactgcaccaccctcaccatccaaatccacatac |
42923914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 64
Target Start/End: Complemental strand, 42924130 - 42924093
Alignment:
| Q |
28 |
ttactaccttatgttaaa-gccaataatttaatcttat |
64 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42924130 |
ttactaccttatgttaaaagccaataatttaatcttat |
42924093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University