View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-102 (Length: 41)
Name: NF4336-Insertion-102
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-102 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 35; Significance: 0.000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.000000000009
Query Start/End: Original strand, 7 - 41
Target Start/End: Complemental strand, 15963219 - 15963185
Alignment:
| Q |
7 |
aaatgttcattaatctgtgctttttgaggagctga |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
15963219 |
aaatgttcattaatctgtgctttttgaggagctga |
15963185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University