View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-103 (Length: 125)
Name: NF4336-Insertion-103
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-103 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 4e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 44 - 125
Target Start/End: Complemental strand, 22687921 - 22687840
Alignment:
| Q |
44 |
cttttacttgattattacatagaaacatagttatcaattggtactttcttgtaggaatgtagtcagctatttagaacagtgg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22687921 |
cttttacttgattattacatagaaacatagttatcaattggtactttcttgtaggaatgtagtcagctatttagaacagtgg |
22687840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 72; Significance: 3e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 3e-33
Query Start/End: Original strand, 42 - 125
Target Start/End: Original strand, 27472180 - 27472263
Alignment:
| Q |
42 |
tgcttttacttgattattacatagaaacatagttatcaattggtactttcttgtaggaatgtagtcagctatttagaacagtgg |
125 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27472180 |
tgcttttacttgattattacataggaacatagttatcaattggtaccttcttataggaatgtagtcagctatttagaacagtgg |
27472263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 14 - 47
Target Start/End: Complemental strand, 33079007 - 33078974
Alignment:
| Q |
14 |
tgttcctctgaaaccatttatagctctatgcttt |
47 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
33079007 |
tgttcttctgaaaccatttatagctctatgcttt |
33078974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Original strand, 19859478 - 19859531
Alignment:
| Q |
44 |
cttttacttgattattacatagaaacatagttatcaattggtactttcttgtag |
97 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||| ||||||| | ||||||| |
|
|
| T |
19859478 |
cttttacttgattattgcatagaaatatagttatcagttggtacctgcttgtag |
19859531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 42 - 121
Target Start/End: Original strand, 24263481 - 24263560
Alignment:
| Q |
42 |
tgcttttacttgattattacatagaaacatagttatcaattggtactttcttgtaggaatgtagtcagctatttagaaca |
121 |
Q |
| |
|
||||||||||| |||| || |||||||| |||||||||||||||| |||| || ||||||| | |||||||||||| |
|
|
| T |
24263481 |
tgcttttactttattactatgtagaaacacagttatcaattggtaccaacttgaagaaatgtagctaactatttagaaca |
24263560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University