View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-104 (Length: 134)
Name: NF4336-Insertion-104
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-104 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 2e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 2e-47
Query Start/End: Original strand, 20 - 134
Target Start/End: Original strand, 2627523 - 2627638
Alignment:
| Q |
20 |
agaattcttcccgtaattctcatgaaagcaaacgatgcaccgccagaagagccc-accacccaattttttatattatgacaatttagttgcatgtggata |
118 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2627523 |
agaattcttctcgtaattcttatgaaagcaaacgatgcaccgccagaagtgccccaccacccaattttttatattatgacaatttagttgcatgtggata |
2627622 |
T |
 |
| Q |
119 |
gcatatgacattaact |
134 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2627623 |
gcatatgacattaact |
2627638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University