View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-106 (Length: 159)
Name: NF4336-Insertion-106
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-106 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 6e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 6e-51
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 1237977 - 1237868
Alignment:
| Q |
25 |
aagaacaatacttttgagaccgatgagtgaccaagaggactattcaatctcagaggcaacagagaatcagttttctactccaccatttggctctaacact |
124 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1237977 |
aagaacaatagttttgagacagatgagtgaccaagaggactattcaatctcagaggcaacagagaatcagttttctactccaccatttggctctaacact |
1237878 |
T |
 |
| Q |
125 |
acttgtgtat |
134 |
Q |
| |
|
|||||||||| |
|
|
| T |
1237877 |
acttgtgtat |
1237868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University