View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4336-Insertion-109 (Length: 41)

Name: NF4336-Insertion-109
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4336-Insertion-109
NF4336-Insertion-109
[»] chr3 (2 HSPs)
chr3 (5-41)||(46975045-46975081)
chr3 (5-41)||(46981032-46981068)


Alignment Details
Target: chr3 (Bit Score: 33; Significance: 0.0000000001; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.0000000001
Query Start/End: Original strand, 5 - 41
Target Start/End: Original strand, 46975045 - 46975081
Alignment:
5 agacatggtatgaccatcatggctgactgcttcgtca 41  Q
    |||||||||||||||||||||||||||||||| ||||    
46975045 agacatggtatgaccatcatggctgactgctttgtca 46975081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.00000003
Query Start/End: Original strand, 5 - 41
Target Start/End: Original strand, 46981032 - 46981068
Alignment:
5 agacatggtatgaccatcatggctgactgcttcgtca 41  Q
    |||||||||||||||||||||| ||||||||| ||||    
46981032 agacatggtatgaccatcatggttgactgctttgtca 46981068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University