View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-112 (Length: 108)
Name: NF4336-Insertion-112
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-112 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 2e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 2e-52
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 47636293 - 47636400
Alignment:
| Q |
1 |
ggtgcatcttatctgaactctttatagtgcacacttcacatgagaaaactgtgcaattgaattcttttgtcaaatttctgtttcattaaactggtttact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47636293 |
ggtgcatcttatctgaactctttatagtgcacacttcacatgagaaaactgtacaattgaattcttttgtcaaatttctgtttcattaaactggtttact |
47636392 |
T |
 |
| Q |
101 |
tttatcgg |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
47636393 |
tttatcgg |
47636400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University