View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4336-Insertion-114 (Length: 110)

Name: NF4336-Insertion-114
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4336-Insertion-114
NF4336-Insertion-114
[»] chr3 (1 HSPs)
chr3 (1-110)||(52671246-52671355)


Alignment Details
Target: chr3 (Bit Score: 106; Significance: 1e-53; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 106; E-Value: 1e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 52671355 - 52671246
Alignment:
1 cattcggtacgtcaacatataagagtatgaagaaatgtactcttaactacaaaccatagacatgcggtgggcaaaaatgtatatattttatatctaatcg 100  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52671355 cattcggtacgtcaacatataagagtatgcagaaatgtactcttaactacaaaccatagacatgcggtgggcaaaaatgtatatattttatatctaatcg 52671256  T
101 tttatgaaga 110  Q
    ||||||||||    
52671255 tttatgaaga 52671246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University