View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-115 (Length: 72)
Name: NF4336-Insertion-115
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-115 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 2e-33
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 39192779 - 39192850
Alignment:
| Q |
1 |
ggaatatacttgtttgtagttatctaagttgttaaagttttgaattaactagctcataaacattctgagatt |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39192779 |
ggaatatacttgtttgtagttatctaagttgttaaagttttgaattaactagctcataaacattctgagatt |
39192850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 39222084 - 39222137
Alignment:
| Q |
19 |
gttatctaagttgttaaagttttgaattaactagctcataaacattctgagatt |
72 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
39222084 |
gttatctaggttgttaatattttgaattaactagatcataaacattttgagatt |
39222137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University