View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4336-Insertion-116 (Length: 71)

Name: NF4336-Insertion-116
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4336-Insertion-116
NF4336-Insertion-116
[»] chr4 (2 HSPs)
chr4 (1-71)||(52481261-52481331)
chr4 (1-71)||(16408021-16408091)
[»] chr2 (4 HSPs)
chr2 (1-71)||(40751875-40751945)
chr2 (2-71)||(41484626-41484695)
chr2 (9-71)||(41477620-41477682)
chr2 (9-63)||(41470740-41470794)


Alignment Details
Target: chr4 (Bit Score: 71; Significance: 7e-33; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 71; E-Value: 7e-33
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 52481331 - 52481261
Alignment:
1 ttattaacttttttcgggcatcttgcaactcgtcattagttttgcgctcctggacaacaagtgttcgttga 71  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52481331 ttattaacttttttcgggcatcttgcaactcgtcattagttttgcgctcctggacaacaagtgttcgttga 52481261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 16408021 - 16408091
Alignment:
1 ttattaacttttttcgggcatcttgcaactcgtcattagttttgcgctcctggacaacaagtgttcgttga 71  Q
    ||||||| ||||| || |||||||||||||||||||||||||||||||| || |||||||||||| |||||    
16408021 ttattaattttttgcgagcatcttgcaactcgtcattagttttgcgctcttgaacaacaagtgtttgttga 16408091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 47; Significance: 1e-18; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 40751945 - 40751875
Alignment:
1 ttattaacttttttcgggcatcttgcaactcgtcattagttttgcgctcctggacaacaagtgttcgttga 71  Q
    ||||||||||||| |||||||||||||| ||||||||||||||||| ||||| ||||| |||||| |||||    
40751945 ttattaactttttgcgggcatcttgcaattcgtcattagttttgcgttcctgaacaaccagtgtttgttga 40751875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 6e-18
Query Start/End: Original strand, 2 - 71
Target Start/End: Complemental strand, 41484695 - 41484626
Alignment:
2 tattaacttttttcgggcatcttgcaactcgtcattagttttgcgctcctggacaacaagtgttcgttga 71  Q
    |||||||||||| |||||||||||||| ||||||||||||||||||||||| || || |||||| |||||    
41484695 tattaactttttgcgggcatcttgcaattcgtcattagttttgcgctcctgaactactagtgtttgttga 41484626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 9 - 71
Target Start/End: Complemental strand, 41477682 - 41477620
Alignment:
9 ttttttcgggcatcttgcaactcgtcattagttttgcgctcctggacaacaagtgttcgttga 71  Q
    ||||| ||||||||||||||||||||||||||||||||||| || ||||| |||||| |||||    
41477682 tttttgcgggcatcttgcaactcgtcattagttttgcgctcttgaacaaccagtgtttgttga 41477620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.00000000000008
Query Start/End: Original strand, 9 - 63
Target Start/End: Complemental strand, 41470794 - 41470740
Alignment:
9 ttttttcgggcatcttgcaactcgtcattagttttgcgctcctggacaacaagtg 63  Q
    ||||| ||||||||||||||||||||||||||||||||||| || ||||| ||||    
41470794 tttttgcgggcatcttgcaactcgtcattagttttgcgctcttgaacaaccagtg 41470740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University