View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-117 (Length: 93)
Name: NF4336-Insertion-117
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-117 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 1e-35; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 6 - 93
Target Start/End: Original strand, 8884222 - 8884308
Alignment:
| Q |
6 |
cctcctcgatttctttaacatactctgcatcaactgcatatttagccatacttttcaaggctttggttaatttctgagagaccaacca |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
8884222 |
cctcctcgatttctttaacatactctgcatcaactgcatatttagccatac-ttgcaaggctttggttaatttctgagagaccaacca |
8884308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University