View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-120 (Length: 126)
Name: NF4336-Insertion-120
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-120 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 8e-65; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 8e-65
Query Start/End: Original strand, 2 - 126
Target Start/End: Complemental strand, 42211083 - 42210959
Alignment:
| Q |
2 |
aacaagctgtcagggaacattcctaaaatcgaagttaacggattgaaaacacttatgatggcaagaaacaattttagtggctcaattccaaatagtctag |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42211083 |
aacaagctgtcagggaacattcctaaaatcgaagttaacggattgaaaacacttatgatggcaagaaacaattttagtggctcaattccaaatagtctag |
42210984 |
T |
|
| Q |
102 |
gggatttgccatcccttgtgacttt |
126 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42210983 |
gggatttgccatcccttgtgacttt |
42210959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 2 - 126
Target Start/End: Complemental strand, 42223299 - 42223175
Alignment:
| Q |
2 |
aacaagctgtcagggaacattcctaaaatcgaagttaacggattgaaaacacttatgatggcaagaaacaattttagtggctcaattccaaatagtctag |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42223299 |
aacatgctgtcagggaacattcctaaaatcgaagttgacggattgaaaacactagtgatggcaagaaacaattttagtggctcaattccaaatagtctag |
42223200 |
T |
|
| Q |
102 |
gggatttgccatcccttgtgacttt |
126 |
Q |
| |
|
| ||||| |||||||||||||||| |
|
|
| T |
42223199 |
gtgatttagcatcccttgtgacttt |
42223175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 64; E-Value: 2e-28
Query Start/End: Original strand, 9 - 126
Target Start/End: Complemental strand, 42198505 - 42198384
Alignment:
| Q |
9 |
tgtcagggaacattcctaaaatcgaagt---taa-cggattgaaaacacttatgatggcaagaaacaattttagtggctcaattccaaatagtctagggg |
104 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||| ||||||||||| |||| ||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42198505 |
tgtcagggaacattcctaaattagaagtaattaagcggattgaaaatacttgtgatggctagaaacaaatttagtggctcaattccaaatagtctagggg |
42198406 |
T |
|
| Q |
105 |
atttgccatcccttgtgacttt |
126 |
Q |
| |
|
|||| |||| ||||||||||| |
|
|
| T |
42198405 |
atttagcatcacttgtgacttt |
42198384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University