View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4336-Insertion-123 (Length: 49)

Name: NF4336-Insertion-123
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4336-Insertion-123
NF4336-Insertion-123
[»] chr2 (1 HSPs)
chr2 (1-49)||(2777944-2777993)


Alignment Details
Target: chr2 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 2777944 - 2777993
Alignment:
1 acatctcttggtcagttcgaagcacaattc-aaaacaacatcaaaattaa 49  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||    
2777944 acatctcttggtcagttcgaagcacaattcaaaaacaacatcaaaattaa 2777993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University