View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-124 (Length: 131)
Name: NF4336-Insertion-124
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-124 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 3e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 3e-46
Query Start/End: Original strand, 3 - 131
Target Start/End: Complemental strand, 46919177 - 46919049
Alignment:
| Q |
3 |
atctgacctttcaagctttgaaagcttttaatattattgttggcaaccttggtcattgtcctaaagttatagaggttatttggtctctttttcccatggg |
102 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46919177 |
atctgacctt-caagctttgaaagcttttaatatt---gttggcaaccttggtcattgtcctaaagttatagaggttatttggtctctttttcccatggg |
46919082 |
T |
|
| Q |
103 |
ttgggtcaa----aataatgatggtgcagctag |
131 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
46919081 |
ttgggtcaaaattaataatgatggtgcagctag |
46919049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University