View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-131 (Length: 111)
Name: NF4336-Insertion-131
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-131 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 12 - 111
Target Start/End: Complemental strand, 38944312 - 38944213
Alignment:
| Q |
12 |
atgaagaatgtctaatgctcagtagcacatatatattctctgatatgacgtgtcactccttcacattgctctctttcactataaattcccatgcaattaa |
111 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38944312 |
atgaagaatgtctaatgctcagtaacacatatatattctctgatatgacgtgtcactccttcacattgctctctttcactataaattcccatgcaattaa |
38944213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University