View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-132 (Length: 54)
Name: NF4336-Insertion-132
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-132 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 33; Significance: 0.0000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 47
Target Start/End: Complemental strand, 41208947 - 41208915
Alignment:
| Q |
15 |
tctctgcagattaaaagaagaagggagaaaaaa |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41208947 |
tctctgcagattaaaagaagaagggagaaaaaa |
41208915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University