View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-133 (Length: 47)
Name: NF4336-Insertion-133
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-133 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 36; Significance: 0.000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.000000000003
Query Start/End: Original strand, 12 - 47
Target Start/End: Complemental strand, 50664012 - 50663977
Alignment:
| Q |
12 |
aaatatagtttcttattattctggcaccctcttttg |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
50664012 |
aaatatagtttcttattattctggcaccctcttttg |
50663977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University