View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-138 (Length: 179)
Name: NF4336-Insertion-138
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-138 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 4 - 179
Target Start/End: Complemental strand, 10769523 - 10769348
Alignment:
| Q |
4 |
ataccaacagaaaccatgtcaaaaatcaactatgttaaatctaagaatgcttcctcaagtgttctttcaagtgacttagttgaagctattactactatat |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10769523 |
ataccaacagaaaccatgtcaaaaatcaactatattaaatctaagaatgcttcctcaagtgttctttcaagtgacttagttgaagctattactactatat |
10769424 |
T |
 |
| Q |
104 |
gttcatccgatattctaaccgaatgtgaattcgctattcgtgtcattaccaaagcttggttgaactctccgggtga |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10769423 |
gttcatccgatattctaaccgaatgtgaattcgctattcgtgtcgttaccaaagcttggttgaactctccgggtga |
10769348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University